Sitemap

 
RL-SAGE

RL-SAGE Tags

Data Description Download Library Sequences

Basic Tag Search:
 
[ Help ]
(eg. CATGAACCAGATGTAGCACCT)

Advanced Search [ Help ]
This tool can be used to search for tags from one or more Rice and M. Grisea RL-SAGE libraries. Advanced search can also be used to search for relative expression of SAGE tags from specific libraries. With Advanced Search tool you can filter the results based on different options such as SAGE tag to genome matches, SAGE tag to EST Contig matches, SAGE tag PHRED quality score etc.. You can also perform different test statistic to identify the relative expression of tag in specific libraries. Search times are proportional to number of tags returned. If the query isn't restrictive, search times can be as long as 30 seconds.

Browse tags by RL-SAGE libraries:
  Rice RL-SAGE Library
 
Library Stage Treatment Unique Tag Count
OSJNGb 24 hr after infection with fungus Che8061 31027
OSJNGd 24 hr after infection with fungus C9240-1 28083
OSJNGf 24 hr after water spray Water +Tween20 (0.1%) 36036
OSJNGg 96 hr after infection with fungus Che8061 57670
  M. Grisea RL-SAGE Library
 
Library Stage Treatment Unique Tag Count
MG_SGa 3 days Fungus grown on a minimum medium [0.2% (w/v) yeast extract, and 1% (w/v) Sucrose at 28C at 200 rpm] 51927